lumi **

Lumi is an ongoing project for Illumina microarray data analysis, including the design of a software package in R/Bioconductor and the discussion of microarray experiment design.

** an open source project at the Bioinformatics Core of the Robert H. Lurie Comprehensive Cancer Center, Northwestern University.

2.26.2008

The new BGX format for annotation

Illumina started providing annotation (manifest) files in the new BGX format.

After a few trial and error, I found the BGX format is actually just a gZIP format [correction after the Commenter!]of the text version.

After unzipping, we can see

[Heading]
Date 21/9/2007
ContentVersion 1.1
FormatVersion 1.0.0
Number of Probes 46643
Number of Controls 1675
[Probes]
Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Unigene_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Probe_Id Array_Address_Id Probe_Type Probe_Start Probe_Sequence Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id
Mus musculus Riken ri|C730035M01|PX00087M15|AK050300|1404 ILMN_204164 THRSP ri|C730035M01|PX00087M15|AK050300|1404 AK050300 Thrsp ILMN_1243094 102690609 S 1127 GCCCTGCCTGACCTGGAAACGTAGAGATTCTTCTGCCTCAGGTTCCAGAG ri|C730035M01|PX00087M15|AK050300|1404-S-1
Good news is that Illumina also provides the control probes information at the end of the file:

[Controls]
Probe_Id Array_Address_Id Reporter_Group_Name Reporter_Group_id Reporter_Composite_map Probe_Sequence
ILMN_1379274 3840114 negative permuted_negative TGAATGAGAACTCTTGGCCCCGGCTCCTTTCACAAAGACGGTTAGCTTGG

Labels: , ,