The new BGX format for annotation

Illumina started providing annotation (manifest) files in the new BGX format.

After a few trial and error, I found the BGX format is actually just a gZIP format [correction after the Commenter!]of the text version.

After unzipping, we can see

[Heading]
Date 21/9/2007
ContentVersion 1.1
FormatVersion 1.0.0
Number of Probes 46643
Number of Controls 1675
[Probes]
Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Unigene_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Probe_Id Array_Address_Id Probe_Type Probe_Start Probe_Sequence Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id
Mus musculus Riken ri|C730035M01|PX00087M15|AK050300|1404 ILMN_204164 THRSP ri|C730035M01|PX00087M15|AK050300|1404 AK050300 Thrsp ILMN_1243094 102690609 S 1127 GCCCTGCCTGACCTGGAAACGTAGAGATTCTTCTGCCTCAGGTTCCAGAG ri|C730035M01|PX00087M15|AK050300|1404-S-1

Good news is that Illumina also provides the control probes information at the end of the file:

[Controls]
Probe_Id Array_Address_Id Reporter_Group_Name Reporter_Group_id Reporter_Composite_map Probe_Sequence
ILMN_1379274 3840114 negative permuted_negative TGAATGAGAACTCTTGGCCCCGGCTCCTTTCACAAAGACGGTTAGCTTGG